Detail of EST/Unigene SRR027943.170374 |
Acc. | SRR027943.170374 |
Internal Acc. | E6L1MXO01EU85R |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein of LHCII type 1 (Fragment) OS=Cucumis sativus E-value=4e-17; Chlorophyll a-b binding protein 13, chloroplastic OS=Petunia sp. E-value=5e-16; Chlorophyll a-b binding protein 48, chloroplastic OS=Zea mays E-value=2e-14; Chlorophyll a-b binding protein 2, chloroplastic OS=Glycine max E-value=4e-11; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=2e-08; |
Length | 272 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGAGTTCAAGTCCTCCCTCGCTGTAAGATCTGGGGATCCGGCCTTGAACCACACAGCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |