Detail of EST/Unigene SRR027943.210913 |
Acc. | SRR027943.210913 |
Internal Acc. | E6L1MXO01D0IQ9 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-28; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=2e-28; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=2e-28; Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-28; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=1e-27; |
Length | 264 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGTCTTGGCCATCTGGGCTTGCCAAGTTTGTTGTTGATGGGAGCTGTTGAGGGATACC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |