| Detail of EST/Unigene SRR027943.214554 |
| Acc. | SRR027943.214554 |
| Internal Acc. | E6L1MXO01CZN4M |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Polyphenol oxidase E, chloroplastic OS=Solanum lycopersicum E-value=5e-12; Polyphenol oxidase F, chloroplastic OS=Solanum lycopersicum E-value=1e-10; Catechol oxidase B, chloroplastic (Fragment) OS=Solanum tuberosum E-value=2e-10; Polyphenol oxidase B, chloroplastic OS=Solanum lycopersicum E-value=1e-09; Polyphenol oxidase, chloroplastic OS=Vitis vinifera E-value=2e-08; |
| Length | 303 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943; |
| Sequence | TCAGTAGAGACCGAGGCGGCCGACATGTTTTGTTTTTTTTTTCTTTTTTTTTTGGGGGAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |