Detail of EST/Unigene SRR027943.214554 |
Acc. | SRR027943.214554 |
Internal Acc. | E6L1MXO01CZN4M |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Polyphenol oxidase E, chloroplastic OS=Solanum lycopersicum E-value=5e-12; Polyphenol oxidase F, chloroplastic OS=Solanum lycopersicum E-value=1e-10; Catechol oxidase B, chloroplastic (Fragment) OS=Solanum tuberosum E-value=2e-10; Polyphenol oxidase B, chloroplastic OS=Solanum lycopersicum E-value=1e-09; Polyphenol oxidase, chloroplastic OS=Vitis vinifera E-value=2e-08; |
Length | 303 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGTAGAGACCGAGGCGGCCGACATGTTTTGTTTTTTTTTTCTTTTTTTTTTGGGGGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |