Detail of EST/Unigene SRR027943.223536 |
Acc. | SRR027943.223536 |
Internal Acc. | E6L1MXO01CEU8C |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=2e-13; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=4e-13; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=4e-13; Chlorophyll a-b binding protein 2, chloroplastic OS=Arabidopsis thaliana E-value=4e-13; Chlorophyll a-b binding protein 1A, chloroplastic OS=Pyrus pyrifolia E-value=5e-13; |
Length | 257 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGCACCAAGCTACTTGACTGGTGAATTCCCTGGGTGACTATGGAATGGGATAACCGAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |