| Detail of EST/Unigene SRR027943.243168 |
| Acc. | SRR027943.243168 |
| Internal Acc. | E6L1MXO01D45M8 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Petunia hybrida E-value=3e-32; Naringenin,2-oxoglutarate 3-dioxygenase OS=Arabidopsis thaliana E-value=6e-32; Flavanone 3-dioxygenase OS=Petroselinum crispum E-value=2e-31; Naringenin,2-oxoglutarate 3-dioxygenase OS=Vitis vinifera E-value=4e-31; Naringenin,2-oxoglutarate 3-dioxygenase OS=Malus domestica E-value=7e-31; |
| Length | 245 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943; |
| Sequence | TCAGGGATACACTTTTGCATCTGGTGCTTGGTATTCTGGAATGTGGCTATCGATAATCTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |