| Detail of EST/Unigene SRR027943.257488 |
| Acc. | SRR027943.257488 |
| Internal Acc. | E6L1MXO02FXYPH |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=9e-34; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=2e-32; Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=2e-27; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=2e-27; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=3e-27; |
| Length | 266 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943; |
| Sequence | TCAGGTTAAGGAATAAGGTGCCAAAAAGTGGTCTGAAGACACCATTTCGAGATGGATTGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |