Detail of EST/Unigene SRR027943.257488 |
Acc. | SRR027943.257488 |
Internal Acc. | E6L1MXO02FXYPH |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=9e-34; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=2e-32; Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=2e-27; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=2e-27; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=3e-27; |
Length | 266 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGGTTAAGGAATAAGGTGCCAAAAAGTGGTCTGAAGACACCATTTCGAGATGGATTGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |