| Detail of EST/Unigene SRR027943.258114 |
| Acc. | SRR027943.258114 |
| Internal Acc. | E6L1MXO02GIQGV |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-oxoacyl-[acyl-carrier-protein] synthase II, chloroplastic OS=Arabidopsis thaliana E-value=2e-32; 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic OS=Hordeum vulgare E-value=8e-22; 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic OS=Arabidopsis thaliana E-value=2e-21; 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial OS=Arabidopsis thaliana E-value=1e-06; Nodulation protein E OS=Rhizobium sp. (strain N33) E-value=2e-06; |
| Length | 238 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943; |
| Sequence | TCAGCCACCAGAGAGCATCATATCAGCTTCACCTTTAATGATATGGTTAGCAGCACTTAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |