Detail of EST/Unigene SRR027943.280389 |
Acc. | SRR027943.280389 |
Internal Acc. | E6L1MXO02FO6RG |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=1e-15; Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=6e-13; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=5e-12; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=2e-11; Omega-3 fatty acid desaturase, chloroplastic (Fragment) OS=Brassica napus E-value=2e-11; |
Length | 209 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGGTCCATGGATTTTTGACCCAACAATGCTTAGGAATAGCTGCCTTAATATCAGAAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |