| Detail of EST/Unigene SRR027943.298875 |
| Acc. | SRR027943.298875 |
| Internal Acc. | E6L1MXO02HBP1P |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Petunia hybrida E-value=7e-20; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic 3 OS=Zea mays E-value=4e-19; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Antirrhinum majus E-value=4e-19; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Mesembryanthemum crystallinum E-value=1e-18; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Craterostigma plantagineum E-value=1e-18; |
| Length | 264 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943; |
| Sequence | TCAGATACTTAAACATATATGTCATGTAATCAACTGAAATGAAGGGATCGTTCACTGCGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |