| Detail of EST/Unigene SRR027943.300824 |
| Acc. | SRR027943.300824 |
| Internal Acc. | E6L1MXO02GEVBJ |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Nicotiana tabacum E-value=6e-22; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Vigna radiata var. radiata E-value=2e-17; Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=3e-17; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=1e-16; Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=2e-16; |
| Length | 229 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943; |
| Sequence | TCAGATCCAACCACATCACAAAAATCATATAAGGAACTCCGTAAAGCTTAAGCAGTTGCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |