Detail of EST/Unigene SRR027943.316583 |
Acc. | SRR027943.316583 |
Internal Acc. | E6L1MXO02GNJ0J |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA thiolase 2, peroxisomal OS=Arabidopsis thaliana E-value=2e-34; 3-ketoacyl-CoA thiolase 1, peroxisomal OS=Arabidopsis thaliana E-value=3e-34; 3-ketoacyl-CoA thiolase 5, peroxisomal OS=Arabidopsis thaliana E-value=8e-30; 3-ketoacyl-CoA thiolase B, peroxisomal OS=Rattus norvegicus E-value=9e-20; 3-ketoacyl-CoA thiolase A, peroxisomal OS=Rattus norvegicus E-value=9e-20; |
Length | 249 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGAGCTCAGGACTGTCTTCTTCCTATGGGTATTACTTCTGAAAATGTTGCACATCGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |