Detail of EST/Unigene SRR027943.336630 |
Acc. | SRR027943.336630 |
Internal Acc. | E6L1MXO02J4NT8 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Glycine max E-value=6e-15; Chlorophyll a-b binding protein, chloroplastic (Fragment) OS=Glycine max E-value=6e-15; Chlorophyll a-b binding protein 1, chloroplastic OS=Zea mays E-value=5e-14; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=2e-13; Chlorophyll a-b binding protein of LHCII type III, chloroplastic OS=Hordeum vulgare E-value=7e-13; |
Length | 259 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGCTGGATCAGCTGAAAGTCCAGCGGTATCCCATCCATAGTACAACCAGGGAATTCAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |