| Detail of EST/Unigene SRR027943.343175 |
| Acc. | SRR027943.343175 |
| Internal Acc. | E6L1MXO02JCS9H |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Petunia hybrida E-value=2e-15; Glyceraldehyde-3-phosphate dehydrogenase OS=Atriplex nummularia E-value=5e-15; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Antirrhinum majus E-value=5e-15; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic 2 OS=Zea mays E-value=7e-15; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic 1 OS=Zea mays E-value=7e-15; |
| Length | 163 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943; |
| Sequence | TCAGCTTTCCCCACAGCCTTGGCTGCTCCAGTACTGCTAGGAATAATGTTGAATGAAGCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |