| Detail of EST/Unigene SRR027943.343842 |
| Acc. | SRR027943.343842 |
| Internal Acc. | E6L1MXO02JK8M0 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Naringenin,2-oxoglutarate 3-dioxygenase OS=Vitis vinifera E-value=5e-18; Naringenin,2-oxoglutarate 3-dioxygenase OS=Hordeum vulgare E-value=5e-18; Flavanone 3-dioxygenase OS=Petroselinum crispum E-value=9e-18; Naringenin,2-oxoglutarate 3-dioxygenase OS=Malus domestica E-value=9e-18; Naringenin,2-oxoglutarate 3-dioxygenase OS=Arabidopsis thaliana E-value=1e-17; |
| Length | 175 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943; |
| Sequence | TCAGTCTAGAATAGTCTCTAGCTCGAATTGGGTATGAAAAGTAAGTAACTATTTCACGCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |