Detail of EST/Unigene SRR027943.344119 |
Acc. | SRR027943.344119 |
Internal Acc. | E6L1MXO02FYQTJ |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=2e-30; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=1e-28; Glutamate--cysteine ligase B, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-26; Glutamate--cysteine ligase B, chloroplastic OS=Oryza sativa subsp. indica E-value=3e-26; Glutamate--cysteine ligase A, chloroplastic OS=Oryza sativa subsp. indica E-value=3e-26; |
Length | 248 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGATATCTGGAAATGAGAGGTGCTGATGGAGGGCCTTGGAGACGGTTATGCGCATTGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |