Detail of EST/Unigene SRR027943.350751 |
Acc. | SRR027943.350751 |
Internal Acc. | E6L1MXO02GJBCG |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Lemna gibba E-value=9e-28; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-27; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. indica E-value=1e-27; Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=2e-27; Chlorophyll a-b binding protein type I, chloroplastic OS=Pinus thunbergii E-value=2e-21; |
Length | 269 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGCACCAACAATACGGTAACCCTCAACAGCTTCCCTATCAACACAACTTGGCAAGCCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |