| Detail of EST/Unigene SRR027943.350751 |
| Acc. | SRR027943.350751 |
| Internal Acc. | E6L1MXO02GJBCG |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Lemna gibba E-value=9e-28; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-27; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. indica E-value=1e-27; Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=2e-27; Chlorophyll a-b binding protein type I, chloroplastic OS=Pinus thunbergii E-value=2e-21; |
| Length | 269 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943; |
| Sequence | TCAGCACCAACAATACGGTAACCCTCAACAGCTTCCCTATCAACACAACTTGGCAAGCCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |