Detail of EST/Unigene SRR027943.366797 |
Acc. | SRR027943.366797 |
Internal Acc. | E6L1MXO02IP9PV |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Nicotiana tabacum E-value=3e-41; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=2e-39; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=5e-39; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=1e-38; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Brassica napus E-value=3e-38; |
Length | 260 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGTGCCAATATCATGGTGAATATTATTAAAAACGCCATAATCGCGATCAATTGTAGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |