Detail of EST/Unigene SRR027943.382614 |
Acc. | SRR027943.382614 |
Internal Acc. | E6L1MXO02JNM5T |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 3-oxoacyl-[acyl-carrier-protein] synthase II, chloroplastic OS=Arabidopsis thaliana E-value=6e-33; 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic OS=Hordeum vulgare E-value=2e-22; 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic OS=Arabidopsis thaliana E-value=6e-22; 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial OS=Arabidopsis thaliana E-value=1e-06; Nodulation protein E OS=Rhizobium sp. (strain N33) E-value=2e-06; |
Length | 242 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGTCCACCAGAGAGCATCATATCAGCTTCACCTTTAATGATATGGTTAGCAGCACTTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |