Detail of EST/Unigene SRR027943.383153 |
Acc. | SRR027943.383153 |
Internal Acc. | E6L1MXO02IGDH0 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Polyphenol oxidase E, chloroplastic OS=Solanum lycopersicum E-value=3e-17; Polyphenol oxidase F, chloroplastic OS=Solanum lycopersicum E-value=3e-17; Catechol oxidase B, chloroplastic (Fragment) OS=Solanum tuberosum E-value=2e-16; Polyphenol oxidase B, chloroplastic OS=Solanum lycopersicum E-value=2e-11; Polyphenol oxidase D, chloroplastic OS=Solanum lycopersicum E-value=2e-10; |
Length | 280 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGCCACCAACTTTGTAAGCACCGTTGCAATAAGCACAATGAATATTAGCTTGTTGTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |