Detail of EST/Unigene SRR027943.390949 |
Acc. | SRR027943.390949 |
Internal Acc. | E6L1MXO02JYFRZ |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=2e-13; Chlorophyll a-b binding protein 1C, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=4e-12; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=5e-12; Chlorophyll a-b binding protein 1A, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=1e-10; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=3e-10; |
Length | 251 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGAAGCAGTGGTATCAACGCAGAGTTACGTCGGGGGATCACAACTAACTTTTACATAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |