Detail of EST/Unigene SRR027943.396693 |
Acc. | SRR027943.396693 |
Internal Acc. | E6L1MXO02H6YMY |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S14, mitochondrial OS=Oenothera berteriana E-value=5e-13; Ribosomal protein S14, mitochondrial OS=Brassica napus E-value=4e-12; Ribosomal protein S14, mitochondrial OS=Vicia faba E-value=2e-11; Ribosomal protein S14, mitochondrial OS=Marchantia polymorpha E-value=3e-06; |
Length | 254 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGAAGCAGTGGTATCAACGCAGAGTTACGTCGGGGGGGGAATTGTATAGCGAATCGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |