Detail of EST/Unigene SRR027943.407981 |
Acc. | SRR027943.407981 |
Internal Acc. | E6L1MXO02HBA4D |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Trans-2,3-enoyl-CoA reductase OS=Rattus norvegicus E-value=3e-12; Trans-2,3-enoyl-CoA reductase OS=Mus musculus E-value=3e-12; Trans-2,3-enoyl-CoA reductase OS=Homo sapiens E-value=3e-12; Trans-2,3-enoyl-CoA reductase OS=Bos taurus E-value=3e-12; Trans-2,3-enoyl-CoA reductase OS=Dictyostelium discoideum E-value=6e-12; |
Length | 282 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGTCTGGGGCCTCTGCTACTCTATCCTATCTTTTACTACTTCCCAGTCTACAAGTTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |