Detail of EST/Unigene SRR027943.429597 |
Acc. | SRR027943.429597 |
Internal Acc. | E6L1MXO02IXBF1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Nicotiana tabacum E-value=6e-37; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Brassica napus E-value=9e-34; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=2e-33; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Glycine max E-value=1e-32; Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=1e-31; |
Length | 246 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGGTTTTTCTGATAGTGCACTATTGAATAGTGTGGTTGGACATATTCTTCATTCTTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |