Detail of EST/Unigene SRR027943.455150 |
Acc. | SRR027943.455150 |
Internal Acc. | E6L1MXO02JQ3VL |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Hordeum vulgare E-value=9e-31; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=1e-30; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=1e-30; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=1e-30; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=2e-30; |
Length | 249 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGTCAGGGAAGACACACCCAAGAGCACCAAGCATAGCCCATCTGCAGTGGATCAACCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |