| Detail of EST/Unigene SRR027943.458151 |
| Acc. | SRR027943.458151 |
| Internal Acc. | E6L1MXO02G8XCC |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 48, chloroplastic OS=Zea mays E-value=8e-28; Chlorophyll a-b binding protein type 2 member 2 (Fragment) OS=Pinus sylvestris E-value=1e-27; Chlorophyll a-b binding protein AB10, chloroplastic OS=Malus domestica E-value=6e-25; Chlorophyll a-b binding protein 3B, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=2e-19; Chlorophyll a-b binding protein 3A, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=2e-19; |
| Length | 250 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943; |
| Sequence | TCAGTTGGTCCATGCACAAAGCATCTTAGTCCATCTGGGCTTGCCAAGTTGTGTTGATGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |