Detail of EST/Unigene SRR027943.462242 |
Acc. | SRR027943.462242 |
Internal Acc. | E6L1MXO02I3KWR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 1 OS=Glycine max E-value=5e-23; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 2 OS=Glycine max E-value=1e-16; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=9e-15; Delta(12) fatty acid dehydrogenase OS=Crepis alpina E-value=3e-13; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Brassica juncea E-value=7e-07; |
Length | 247 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGGAGAACTCCAGCATCAGAAAGGAAGTATTCTGTAGCCTCTCGCGGTTGTTGTAGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |