| Detail of EST/Unigene SRR027943.472761 |
| Acc. | SRR027943.472761 |
| Internal Acc. | E6L1MXO02G0QXI |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S14, mitochondrial OS=Oenothera berteriana E-value=9e-23; Ribosomal protein S14, mitochondrial OS=Brassica napus E-value=3e-21; Ribosomal protein S14, mitochondrial OS=Vicia faba E-value=6e-21; Ribosomal protein S14, mitochondrial OS=Marchantia polymorpha E-value=1e-17; 30S ribosomal protein S14 OS=Maricaulis maris (strain MCS10) E-value=1e-15; |
| Length | 279 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943; |
| Sequence | TCAGCTAGGCTTTAGTATATAATATCCAGTTAGTTAATACTCCTAAATCTTGAAAAGAAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |