| Detail of EST/Unigene SRR027943.478194 |
| Acc. | SRR027943.478194 |
| Internal Acc. | E6L1MXO02FIU8T |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Dianthus caryophyllus E-value=3e-37; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Antirrhinum majus E-value=3e-37; Glyceraldehyde-3-phosphate dehydrogenase OS=Atriplex nummularia E-value=4e-37; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Pisum sativum E-value=5e-37; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic (Fragment) OS=Nicotiana tabacum E-value=1e-36; |
| Length | 242 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943; |
| Sequence | TCAGCTATGTTTGTTGTTGGTGTCAATGAGAAGGAATACAAGCCAGAGCTCAATATCGTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |