Detail of EST/Unigene SRR027943.51324 |
Acc. | SRR027943.51324 |
Internal Acc. | E6L1MXO01CGMBP |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=4e-35; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=4e-35; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=4e-35; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=4e-35; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=4e-35; |
Length | 247 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGAAGCAGTGGTATCAACGCAGAGTACGCGGGCAGATGGGCTATGCTTGGTGCTCTTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |