Detail of EST/Unigene SRR027943.70863 |
Acc. | SRR027943.70863 |
Internal Acc. | E6L1MXO01AKB9C |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein, chloroplastic OS=Triticum aestivum E-value=3e-18; Chlorophyll a-b binding protein 151, chloroplastic OS=Gossypium hirsutum E-value=7e-18; Chlorophyll a-b binding protein 1A, chloroplastic OS=Pyrus pyrifolia E-value=9e-18; Chlorophyll a-b binding protein type 2 member 1A, chloroplastic OS=Pinus sylvestris E-value=9e-18; Chlorophyll a-b binding protein type 2 member 2 (Fragment) OS=Pinus sylvestris E-value=2e-17; |
Length | 233 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGCCACCAGCAATACGGTAACCCTCAACGGCTCCCATCAACACAACTTGGCAAGCCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |