Detail of EST/Unigene SRR027943.71042 |
Acc. | SRR027943.71042 |
Internal Acc. | E6L1MXO01DYLR8 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=4e-21; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=2e-20; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=6e-20; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=9e-20; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=2e-19; |
Length | 264 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGACCAGAGAATGGTCCCAAGTACTTAACACGGTCAGGACCATACCATGGGCTACCAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |