Detail of EST/Unigene SRR027943.71570 |
Acc. | SRR027943.71570 |
Internal Acc. | E6L1MXO01BUYWY |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=9e-12; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=8e-11; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=9e-10; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=8e-09; Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=1e-08; |
Length | 260 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGAAGCAGTGGTATCAACGCAGAGTACGCGGGCAAAACAGGTGTAACACCAGCTGAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |