| Detail of EST/Unigene SRR027943.89111 |
| Acc. | SRR027943.89111 |
| Internal Acc. | E6L1MXO01ETIT0 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ent-copalyl diphosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=9e-10; Ent-copalyl diphosphate synthase, chloroplastic OS=Pisum sativum E-value=2e-07; Isopimaradiene synthase, chloroplastic OS=Picea abies E-value=9e-07; Abietadiene synthase, chloroplastic OS=Abies grandis E-value=1e-06; Levopimaradiene synthase, chloroplastic OS=Pinus taeda E-value=1e-06; |
| Length | 188 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943; |
| Sequence | TCAGGCAAGGAATTCAAATATTTGTGAAGTTGATACTACATGCATGGCTATTAGGTTACT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |