Detail of EST/Unigene SRR027943.89111 |
Acc. | SRR027943.89111 |
Internal Acc. | E6L1MXO01ETIT0 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ent-copalyl diphosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=9e-10; Ent-copalyl diphosphate synthase, chloroplastic OS=Pisum sativum E-value=2e-07; Isopimaradiene synthase, chloroplastic OS=Picea abies E-value=9e-07; Abietadiene synthase, chloroplastic OS=Abies grandis E-value=1e-06; Levopimaradiene synthase, chloroplastic OS=Pinus taeda E-value=1e-06; |
Length | 188 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943; |
Sequence | TCAGGCAAGGAATTCAAATATTTGTGAAGTTGATACTACATGCATGGCTATTAGGTTACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |