Detail of EST/Unigene TCAA52863 |
Acc. | TCAA52863 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Alcohol dehydrogenase 3 OS=Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139) E-value=4e-80; Alcohol dehydrogenase 1 OS=Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / NRRL 3357 / JCM 12722 / SRRC 167) E-value=2e-77; Alcohol dehydrogenase 1 OS=Kluyveromyces marxianus E-value=7e-77; Alcohol dehydrogenase 2 OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) E-value=1e-76; Alcohol dehydrogenase 1 OS=Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545) E-value=2e-76; |
Length | 1191 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAIY (9 ESTs); |
Sequence | CCGAGCTCAAGCCCGGCGAATGTCTCGTCCGCCTTGAATGCAGTGGTGTCTGCCACACCG |
EST members of Unigene | EY036106 EY042334 EY042335 EY040781 EY040782 EY036315 EY036316 EY034294 EY034295 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 |
EC | 1.1.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829955 |
Trichome-related Gene from Literature | 829955 |