Detail of EST/Unigene TCCS20221 |
Acc. | TCCS20221 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA thiolase 2, peroxisomal OS=Arabidopsis thaliana E-value=4e-90; 3-ketoacyl-CoA thiolase 1, peroxisomal OS=Arabidopsis thaliana E-value=2e-82; 3-ketoacyl-CoA thiolase 5, peroxisomal OS=Arabidopsis thaliana E-value=7e-66; 3-ketoacyl-CoA thiolase, peroxisomal OS=Homo sapiens E-value=4e-41; 3-ketoacyl-CoA thiolase B, peroxisomal OS=Mus musculus E-value=1e-39; |
Length | 767 nt |
Species | Cannabis sativa |
Belonged EST Libraries | LIBEST_027499 (7 ESTs); CS_GT (2 ESTs); |
Sequence | GACCTCAATTTTCCATTCCCCATTTCCAAAATTCAGAACCAGACCTCAATTCCCCACCGA |
EST members of Unigene | GR221303 JK499841 JK497715 JK501883 JK501092 GR221140 JK499567 JK500506 JK495161 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00362 Benzoate degradation via hydroxylation > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07513 acetyl-CoA acyltransferase 1; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K07513 acetyl-CoA acyltransferase 1 |
EC | 2.3.1.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817876 |
Trichome-related Gene from Literature | 817876 |