| Detail of EST/Unigene TCHL53103 |
| Acc. | TCHL53103 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA thiolase 2, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase 1, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase 5, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase A, peroxisomal OS=Mus musculus E-value=1e-84; 3-ketoacyl-CoA thiolase B, peroxisomal OS=Rattus norvegicus E-value=2e-84; |
| Length | 1043 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546172 (5 ESTs); SRR546168 (4 ESTs); SRR546165 (1 ESTs); SRR546170 (1 ESTs); |
| Sequence | AGTAGACAATATTAGCAGAGTCAGGAACATGAACCCAAAAGTAGACACCTTTGCACAAGC |
| EST members of Unigene | SRR546165.256638 SRR546165.231900 SRR546170.136393 SRR546165.128885 SRR546172.41033 GD245643 SRR546170.105287 SRR546170.86536 SRR546172.116379 SRR546168.69351 SRR546172.33703 SRR546170.101057 SRR546170.117131 SRR546172.71611 SRR546170.155578 SRR546170.32493 SRR546172.35848 SRR546170.93344 SRR546172.154677 SRR546170.133909 SRR546168.86013 SRR546170.85033 SRR546172.18381 SRR546172.47180 SRR546165.250111 SRR546172.118815 SRR546172.45380 SRR546172.72621 SRR546168.56517 SRR546172.144875 SRR546170.131257 SRR546168.120260 SRR546172.135396 SRR546170.132785 SRR546172.27795 SRR546172.2853 SRR546170.46687 SRR546172.161952 SRR546172.98384 SRR546168.130771 SRR546172.48327 SRR546170.136728 SRR546165.39944 SRR546172.109968 SRR546172.20484 SRR546168.20804 SRR546172.18921 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00362 Benzoate degradation via hydroxylation > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07513 acetyl-CoA acyltransferase 1; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K07513 acetyl-CoA acyltransferase 1 |
| EC | 2.3.1.16 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817876 |
| Trichome-related Gene from Literature | 817876 |