| Detail of EST/Unigene TCHL54292 |
| Acc. | TCHL54292 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | WD-40 repeat-containing protein MSI1 OS=Solanum lycopersicum E-value=0; WD-40 repeat-containing protein MSI1 OS=Arabidopsis thaliana E-value=0; Histone-binding protein RBBP4 OS=Mus musculus E-value=0; Histone-binding protein RBBP4 OS=Homo sapiens E-value=0; Histone-binding protein RBBP4 OS=Bos taurus E-value=0; |
| Length | 1593 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165 (12 ESTs); SRR546170 (9 ESTs); SRR546168 (8 ESTs); SRR546172 (4 ESTs); HLUPJN1 (2 ESTs); |
| Sequence | GAGAAAGTCTGAGAAAGTCGAAGAAAGTGTGCGATTGAGGTTGAGATAGGGAAAACGAAT |
| EST members of Unigene | SRR546165.103770 SRR546168.100102 SRR546170.30537 SRR546165.215271 SRR546165.225514 SRR546170.37097 SRR546165.159419 SRR546170.103770 SRR546168.82924 SRR546172.15542 SRR546172.114303 SRR546170.36550 SRR546168.85830 SRR546165.239851 SRR546168.58407 SRR546170.144755 SRR546168.132925 SRR546168.14667 SRR546172.146696 SRR546172.26980 SRR546168.32139 SRR546165.25768 SRR546165.116400 SRR546168.108678 SRR546170.95144 SRR546170.59808 SRR546165.107537 GD244659 GD243872 SRR546165.323630 SRR546170.93266 SRR546165.209026 SRR546170.51923 SRR546165.222746 SRR546165.287087 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.2 H+- or Na+-translocating F-type, V-type and A-type ATPase superfamily F-ATPase |
| Probeset |
|
| Corresponding NCBI Gene | 835935 |
| Trichome-related Gene from Literature | 835935 |