| Detail of EST/Unigene TCHL54614 |
| Acc. | TCHL54614 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable WRKY transcription factor 70 OS=Arabidopsis thaliana E-value=5e-36; Probable WRKY transcription factor 54 OS=Arabidopsis thaliana E-value=5e-34; Probable WRKY transcription factor 67 OS=Arabidopsis thaliana E-value=2e-20; Probable WRKY transcription factor 63 OS=Arabidopsis thaliana E-value=1e-18; Probable WRKY transcription factor 30 OS=Arabidopsis thaliana E-value=2e-18; |
| Length | 1481 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165 (40 ESTs); SRR546172 (14 ESTs); SRR546170 (7 ESTs); SRR546168 (4 ESTs); HL_HIF_HSS (1 ESTs); |
| Sequence | CACTAAGCACTTCATGTTCATATATTGTTTTCTAAAATATATATACTGTGCAAACATCAC |
| EST members of Unigene | SRR546170.48875 SRR546165.92165 SRR546165.7705 SRR546172.18221 SRR546172.128569 SRR546165.130631 SRR546165.71477 SRR546165.274779 SRR546165.24517 SRR546165.175433 SRR546172.106135 SRR546172.111727 SRR546165.201508 SRR546172.40996 SRR546172.34611 SRR546165.291991 SRR546165.60287 SRR546165.214695 SRR546165.63218 SRR546165.212598 SRR546170.142619 SRR546165.176456 SRR546165.261483 CO653849 SRR546168.45825 SRR546165.213548 SRR546165.68999 SRR546165.233456 SRR546165.99910 SRR546170.22612 SRR546172.80653 SRR546172.101721 SRR546172.61371 SRR546170.165835 SRR546165.273722 SRR546165.300961 SRR546165.14571 SRR546165.30811 SRR546170.139960 SRR546172.104894 SRR546168.75253 SRR546172.100058 SRR546165.46649 SRR546165.48580 SRR546165.223087 SRR546165.167233 SRR546168.92055 SRR546165.229642 SRR546165.246480 SRR546172.161701 SRR546165.189275 SRR546165.46300 SRR546165.280128 SRR546165.177123 SRR546165.111418 SRR546172.97967 SRR546168.86877 SRR546165.238183 SRR546170.61551 SRR546165.313343 SRR546165.20572 SRR546165.101349 SRR546165.4132 SRR546170.70045 SRR546165.131117 SRR546172.163261 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824807 |
| Trichome-related Gene from Literature | 824807 |