Detail of EST/Unigene TCHL55021 |
Acc. | TCHL55021 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Trans-2,3-enoyl-CoA reductase OS=Dictyostelium discoideum E-value=4e-56; Trans-2,3-enoyl-CoA reductase OS=Rattus norvegicus E-value=2e-51; Trans-2,3-enoyl-CoA reductase OS=Mus musculus E-value=2e-51; Trans-2,3-enoyl-CoA reductase OS=Bos taurus E-value=2e-51; Trans-2,3-enoyl-CoA reductase OS=Homo sapiens E-value=5e-51; |
Length | 1388 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165 (36 ESTs); SRR546172 (13 ESTs); SRR546168 (5 ESTs); SRR546170 (4 ESTs); |
Sequence | GCTAGGAGTATAAAGTCATTATTTAGGAGAAGGTTTCAATCCAAGAGTACAGAGAACAAC |
EST members of Unigene | SRR546165.246749 SRR546165.231873 SRR546165.211768 SRR546172.121799 SRR546165.10026 SRR546165.200168 SRR546168.16983 SRR546172.59932 SRR546172.16444 SRR546165.177345 SRR546165.161890 SRR546165.134833 SRR546165.96761 SRR546165.304731 SRR546168.48115 SRR546172.121037 SRR546165.94142 SRR546172.74681 SRR546168.84281 SRR546165.75575 SRR546165.195381 SRR546165.28417 SRR546172.81623 SRR546165.54499 SRR546165.260882 SRR546172.9143 SRR546172.161221 SRR546168.133913 SRR546165.87964 SRR546172.101387 SRR546170.79320 SRR546170.23094 SRR546172.40370 SRR546165.187732 SRR546165.44344 SRR546170.60957 SRR546165.121046 SRR546165.145598 SRR546165.95533 SRR546165.16871 SRR546165.253019 SRR546165.200641 SRR546165.157595 SRR546172.100471 SRR546165.456 SRR546172.32480 SRR546172.48517 SRR546168.49418 SRR546170.49790 SRR546165.218879 SRR546165.242646 SRR546165.280327 SRR546165.174998 SRR546165.124365 SRR546165.193930 SRR546165.142921 SRR546165.122812 SRR546165.325338 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10258 enoyl reductase |
EC | 1.3.1.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824702 |
Trichome-related Gene from Literature | 824702 |