Detail of EST/Unigene TCHL56223 |
Acc. | TCHL56223 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | WRKY transcription factor 6 OS=Arabidopsis thaliana E-value=7e-72; Probable WRKY transcription factor 31 OS=Arabidopsis thaliana E-value=9e-72; Probable WRKY transcription factor 42 OS=Arabidopsis thaliana E-value=1e-67; Probable WRKY transcription factor 47 OS=Arabidopsis thaliana E-value=7e-48; Probable WRKY transcription factor 61 OS=Arabidopsis thaliana E-value=7e-35; |
Length | 1215 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165 (24 ESTs); SRR546170 (15 ESTs); SRR546172 (13 ESTs); HL_TRI (1 ESTs); HLUTR3CH (1 ESTs); |
Sequence | TAAGAATATCTATGTGTATTGGAATTTGAAATAGTACATAATTGTGGCTAATACAATAAC |
EST members of Unigene | SRR546170.163814 SRR546170.26248 SRR546165.67991 SRR546165.142783 SRR546170.49063 SRR546165.259490 SRR546172.157701 SRR546170.80713 SRR546165.185639 SRR546165.75875 SRR546170.44768 SRR546170.163203 SRR546170.11770 EX518413 SRR546165.233045 SRR546170.75012 SRR546165.211251 SRR546170.7377 SRR546165.111135 SRR546172.119716 SRR546165.194028 SRR546172.45502 SRR546165.33445 SRR546165.191118 SRR546172.103072 SRR546172.170687 SRR546165.12790 GD250988 SRR546170.62890 SRR546170.65970 SRR546165.100756 SRR546165.305207 SRR546170.61136 SRR546172.104881 SRR546172.28345 SRR546165.143640 SRR546172.76452 SRR546165.7773 SRR546165.262869 SRR546165.67922 SRR546165.235665 SRR546172.81906 SRR546172.77675 SRR546165.218872 SRR546170.24659 SRR546172.80571 SRR546165.15376 SRR546170.58472 SRR546165.134225 SRR546172.11573 SRR546165.43779 SRR546165.216537 SRR546172.170605 SRR546170.116027 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | WRKY |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842527 |
Trichome-related Gene from Literature | 842527 |