Detail of EST/Unigene TCHL56696 |
Acc. | TCHL56696 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chaperone protein dnaJ 15 OS=Arabidopsis thaliana E-value=0; Chaperone protein dnaJ 16 OS=Arabidopsis thaliana E-value=9e-74; Chaperone protein dnaJ 39 OS=Arabidopsis thaliana E-value=5e-59; |
Length | 1165 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165 (12 ESTs); SRR546170 (11 ESTs); SRR546168 (10 ESTs); SRR546172 (8 ESTs); HLUPJN1 (1 ESTs); HLUTR3CH (1 ESTs); |
Sequence | AAGATTATATACCAACCAATTCAAACCCCACAACAGCATCACAAAGAATGCTCCCAAAAA |
EST members of Unigene | SRR546168.89281 SRR546172.23058 SRR546170.98337 SRR546168.114003 SRR546165.8677 SRR546170.77276 SRR546170.73992 SRR546172.48940 SRR546172.167382 SRR546165.310345 SRR546172.126072 SRR546168.106324 SRR546165.94924 SRR546170.160607 SRR546170.141650 SRR546172.43969 SRR546168.135104 SRR546165.253565 SRR546172.105603 SRR546168.20510 SRR546168.59866 SRR546165.169043 SRR546170.111802 SRR546165.54169 SRR546165.31759 SRR546170.156182 SRR546172.46316 SRR546172.13453 SRR546170.133557 SRR546168.93389 SRR546168.41411 SRR546165.17436 SRR546165.50717 SRR546170.71588 SRR546170.158177 SRR546165.91911 SRR546170.26588 SRR546165.185820 GD253324 GD244580 SRR546165.83587 SRR546168.22527 SRR546168.109468 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843166 |
Trichome-related Gene from Literature | 843166 |