| Detail of EST/Unigene TCHL57178 |
| Acc. | TCHL57178 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Flavonoid 3'-monooxygenase OS=Petunia hybrida E-value=0; Flavonoid 3'-monooxygenase OS=Arabidopsis thaliana E-value=0; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=1e-93; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=1e-93; Flavonoid 3',5'-hydroxylase 1 OS=Petunia hybrida E-value=2e-90; |
| Length | 1113 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546172 (15 ESTs); SRR546165 (13 ESTs); SRR546168 (7 ESTs); SRR546170 (6 ESTs); HL_TRI (2 ESTs); |
| Sequence | GTTAACCCAATATCATATTTCATAATCCCAACCTTGGGAAAACTTCCCCTTCTTTTATTG |
| EST members of Unigene | SRR546170.50430 SRR546170.40575 SRR546168.80770 SRR546170.14289 SRR546165.267249 SRR546165.123647 SRR546165.96978 SRR546170.159757 SRR546172.84074 SRR546168.88709 SRR546165.60876 SRR546172.129201 SRR546168.8362 SRR546165.284096 SRR546172.90533 SRR546168.136065 SRR546172.113332 SRR546165.106100 SRR546172.24622 EX518939 SRR546165.200142 SRR546172.100309 SRR546172.64364 SRR546165.53990 SRR546165.52250 SRR546168.85686 SRR546170.146129 SRR546165.223071 SRR546172.82059 SRR546168.120830 SRR546172.62539 SRR546172.57704 SRR546168.45697 SRR546165.31402 SRR546172.28224 EX519182 SRR546165.51905 SRR546172.96039 SRR546172.108593 SRR546172.153024 SRR546165.8795 SRR546170.19816 SRR546172.144137 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830693 |
| Trichome-related Gene from Literature | 830693 |