Detail of EST/Unigene TCHL57892 |
Acc. | TCHL57892 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | WRKY transcription factor 1 OS=Arabidopsis thaliana E-value=7e-33; Probable WRKY transcription factor 20 OS=Arabidopsis thaliana E-value=4e-31; Probable WRKY transcription factor 2 OS=Arabidopsis thaliana E-value=1e-30; Probable WRKY transcription factor 33 OS=Arabidopsis thaliana E-value=9e-30; Probable WRKY transcription factor 3 OS=Arabidopsis thaliana E-value=1e-27; |
Length | 1046 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165 (10 ESTs); SRR546170 (8 ESTs); SRR546172 (8 ESTs); SRR546168 (2 ESTs); HLUPLC (1 ESTs); |
Sequence | ACCACAGAAGATAAACCAACCTCAACCAGCGGACCACGAGTTGTTGTTCAGACTCTAAGT |
EST members of Unigene | SRR546165.243863 SRR546172.100929 SRR546165.85589 SRR546172.79074 SRR546170.92522 SRR546170.87516 SRR546172.45286 SRR546165.186098 GD245665 SRR546165.14500 SRR546170.72862 SRR546172.97490 SRR546172.148320 SRR546165.70307 SRR546172.35400 SRR546170.14054 SRR546170.120227 SRR546168.84316 SRR546170.20550 SRR546165.174179 SRR546172.29517 SRR546172.104706 SRR546165.167631 SRR546170.123364 SRR546165.293051 SRR546165.180028 SRR546170.55193 SRR546168.58502 SRR546165.70472 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | WRKY |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 815035 |
Trichome-related Gene from Literature | 815035 |