Detail of EST/Unigene TCHL57985 |
Acc. | TCHL57985 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | E3 ubiquitin-protein ligase UPL3 OS=Arabidopsis thaliana E-value=1e-95; E3 ubiquitin-protein ligase UPL4 OS=Arabidopsis thaliana E-value=4e-59; Probable E3 ubiquitin-protein ligase TRIP12 OS=Homo sapiens E-value=1e-46; Probable ubiquitin fusion degradation protein C12B10.01c OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=1e-39; Ubiquitin fusion degradation protein 4 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=3e-35; |
Length | 1039 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165 (21 ESTs); SRR546168 (12 ESTs); SRR546172 (10 ESTs); SRR546170 (9 ESTs); HLUTR3CH (1 ESTs); |
Sequence | CATAACGAAATATTTCAAATGTTGGCTCTTTCTTCCCTTTCATCATTTATGCAAATACAT |
EST members of Unigene | SRR546165.5581 SRR546168.74013 SRR546165.167350 SRR546168.106667 SRR546168.27070 SRR546170.84235 SRR546168.101830 SRR546172.154257 SRR546165.197477 SRR546170.373 SRR546170.96195 SRR546165.322885 SRR546172.88580 GD251411 SRR546168.93377 SRR546165.314825 SRR546168.114239 SRR546165.107084 SRR546168.134916 SRR546172.65999 SRR546170.68235 SRR546165.250663 SRR546165.160032 SRR546165.320807 SRR546170.89672 SRR546170.37729 SRR546165.137369 SRR546170.49907 SRR546172.145100 SRR546172.163262 SRR546165.162042 SRR546168.2623 SRR546165.195846 SRR546170.68671 SRR546172.106046 SRR546165.324336 SRR546165.116198 SRR546172.117241 SRR546172.128819 SRR546168.91130 SRR546172.127912 SRR546168.56016 SRR546165.285970 SRR546165.301614 SRR546168.103728 SRR546168.20256 SRR546170.121095 SRR546165.133475 SRR546172.138759 SRR546165.43229 SRR546165.274539 SRR546165.208046 SRR546165.237809 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K10590 E3 ubiquitin-protein ligase TRIP12 |
EC | 6.3.2.19 |
Transcription Factor Family | |
Transporter Classification Family | 8.A.3 Cytoplasmic membrane-periplasmic auxiliary-1 protein MPA1 plus a cytoplasmic domain MPA1-C or MPA1+C |
Probeset |
|
Corresponding NCBI Gene | 830017 |
Trichome-related Gene from Literature | 830017 |