Detail of EST/Unigene TCHL59587 |
Acc. | TCHL59587 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Dedicator of cytokinesis protein 11 OS=Homo sapiens E-value=8e-21; Dedicator of cytokinesis protein 11 OS=Mus musculus E-value=5e-20; Dedicator of cytokinesis protein 9 OS=Homo sapiens E-value=7e-20; Dedicator of cytokinesis protein 9 OS=Mus musculus E-value=9e-20; Dedicator of cytokinesis protein 9 (Fragment) OS=Rattus norvegicus E-value=3e-19; |
Length | 896 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546170 (15 ESTs); SRR546165 (8 ESTs); SRR546168 (6 ESTs); SRR546172 (4 ESTs); |
Sequence | ATGCAGTCATGGAGGATGAAGATTTGGGTAGCAGAAGGGAGAGAATCTTCTCTCTTTCAA |
EST members of Unigene | SRR546168.104908 SRR546165.156112 SRR546165.96397 SRR546165.210405 SRR546170.7112 SRR546170.113364 SRR546168.91590 SRR546170.127515 SRR546170.136021 SRR546170.75176 SRR546165.137799 SRR546165.239450 SRR546170.107642 SRR546170.106110 SRR546168.136277 SRR546170.70863 SRR546168.30490 SRR546168.69131 SRR546170.122363 SRR546170.38904 SRR546172.119946 SRR546168.40657 SRR546165.17287 SRR546165.57679 SRR546170.87636 SRR546172.42896 SRR546172.45410 SRR546170.85345 SRR546172.126390 SRR546170.92874 SRR546170.157597 SRR546170.44765 SRR546165.225451 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827328 |
Trichome-related Gene from Literature | 827328 |