| Detail of EST/Unigene TCHL59702 |
| Acc. | TCHL59702 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-82; 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=4e-81; 1-deoxy-D-xylulose-5-phosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-80; Probable 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Capsicum annuum E-value=2e-79; 1-deoxy-D-xylulose-5-phosphate synthase OS=Rhodopseudomonas palustris (strain BisB5) E-value=3e-54; |
| Length | 885 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546172 (11 ESTs); SRR546168 (6 ESTs); |
| Sequence | ACAGAGGTGGTCTTGTTGGTGCTGATGGTCCAACTCATTGTGGTGCCTTTGACATAACTT |
| EST members of Unigene | SRR546168.135605 SRR546172.49892 SRR546168.101807 SRR546172.149222 SRR546172.156954 SRR546172.23827 SRR546168.119441 SRR546172.168706 SRR546172.36536 SRR546172.68606 SRR546172.51927 SRR546172.49037 SRR546172.23533 SRR546172.118619 SRR546168.6501 SRR546168.112387 SRR546168.128628 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K00615 transketolase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00615 transketolase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01051 Biosynthesis of ansamycins > K00615 transketolase |
| EC | 2.2.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827230 |
| Trichome-related Gene from Literature | 827230 |