Detail of EST/Unigene TCHL63270 |
Acc. | TCHL63270 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Protein WAX2 OS=Arabidopsis thaliana E-value=5e-74; |
Length | 565 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546172 (7 ESTs); HLUPLC (5 ESTs); SRR546165 (3 ESTs); SRR546168 (1 ESTs); |
Sequence | GCCACTACTAAGCTTGGAAGAGCCATTGCTCTCTACCTTTGCAGAAGAAAAGTTCGAGTC |
EST members of Unigene | SRR546165.112245 SRR546172.6613 GD246291 SRR546172.105190 SRR546168.49669 SRR546172.53433 GD245271 SRR546172.60913 GD245946 SRR546165.313685 GD246022 SRR546172.98567 SRR546172.81751 SRR546172.149969 SRR546165.87878 GD245952 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835889 |
Trichome-related Gene from Literature | 835889 |