Detail of EST/Unigene TCMS40120 |
Acc. | TCMS40120 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem II reaction center W protein, chloroplastic OS=Spinacia oleracea E-value=1e-25; Photosystem II reaction center W protein, chloroplastic OS=Arabidopsis thaliana E-value=6e-22; Photosystem II reaction center W protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-14; Photosystem II reaction center W protein, chloroplastic OS=Chlamydomonas reinhardtii E-value=8e-09; |
Length | 606 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (2 ESTs); |
Sequence | TCCACGCTGTGTGGTGCATAGGTTGACAATGCACCAATGCTAATAAACTAATATTACAAC |
EST members of Unigene | CO515960 CO515447 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1658.1.S1_at
|
Corresponding NCBI Gene | 817606 |
Trichome-related Gene from Literature | N/A |