| Detail of EST/Unigene TCMS40120 |
| Acc. | TCMS40120 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem II reaction center W protein, chloroplastic OS=Spinacia oleracea E-value=1e-25; Photosystem II reaction center W protein, chloroplastic OS=Arabidopsis thaliana E-value=6e-22; Photosystem II reaction center W protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-14; Photosystem II reaction center W protein, chloroplastic OS=Chlamydomonas reinhardtii E-value=8e-09; |
| Length | 606 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (2 ESTs); |
| Sequence | TCCACGCTGTGTGGTGCATAGGTTGACAATGCACCAATGCTAATAAACTAATATTACAAC |
| EST members of Unigene | CO515960 CO515447 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1658.1.S1_at
|
| Corresponding NCBI Gene | 817606 |
| Trichome-related Gene from Literature | N/A |