Detail of EST/Unigene TCMS40128 |
Acc. | TCMS40128 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | RING-box protein 1a OS=Arabidopsis thaliana E-value=4e-53; RING-box protein 1 OS=Salmo salar E-value=6e-51; E3 ubiquitin-protein ligase RBX1 OS=Mus musculus E-value=6e-51; E3 ubiquitin-protein ligase RBX1 OS=Homo sapiens E-value=6e-51; RING-box protein 1A OS=Drosophila melanogaster E-value=1e-50; |
Length | 582 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (2 ESTs); |
Sequence | TTGCGAGAAAACGATTCATCATGTCGACACTCGATTCCGACGTAACCATGGTTCCCGCCG |
EST members of Unigene | CO517107 CO513951 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03868 RING-box protein 1; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K03868 RING-box protein 1; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K03868 RING-box protein 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03868 RING-box protein 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1780.1.S1_at
|
Corresponding NCBI Gene | 832179 |
Trichome-related Gene from Literature | N/A |