Detail of EST/Unigene TCMS40133 |
Acc. | TCMS40133 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Soyasapogenol B glucuronide galactosyltransferase OS=Glycine max E-value=4e-43; UDP-glycosyltransferase 73C2 OS=Arabidopsis thaliana E-value=2e-37; UDP-glycosyltransferase 73C4 OS=Arabidopsis thaliana E-value=6e-37; UDP-glycosyltransferase 73C1 OS=Arabidopsis thaliana E-value=7e-37; UDP-glycosyltransferase 73C6 OS=Arabidopsis thaliana E-value=1e-36; |
Length | 706 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (2 ESTs); |
Sequence | GGGATATGGAATTGGGCACCACAGCTCCTTATATTGGATCACCCTGCAGCAGGAGCGATT |
EST members of Unigene | CO514990 CO513145 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase; |
EC | 2.4.1.17 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1932.1.S1_at
|
Corresponding NCBI Gene | 818248 |
Trichome-related Gene from Literature | N/A |